| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.162140 |
| Chromosome: | chromosome 6 |
| Location: | 1119558 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256900 | SND1C | SAND domain-encoding short ORF; (1 of 68) 2.1.1.43 - Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCGACAGCGGCTGCTGGCGAGCGAGTC |
| Internal bar code: | GTGGGAGCGAAGTCGTGGGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1101 |
| LEAP-Seq percent confirming: | 99.7628 |
| LEAP-Seq n confirming: | 4626 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGATTGTCTTGCTGTCGCT |
| Suggested primer 2: | TGACTGAACCTGCATTCTGC |