| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.162143 |
| Chromosome: | chromosome 15 |
| Location: | 825699 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g639650 | RAP24,OPR92,NCL11 | Nuclear Control of chloroplast Like 11 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGACGCACTGACGAATGCCGAGGAGAA |
| Internal bar code: | GGGGAGGGCAAATGGAGAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 243 |
| LEAP-Seq percent confirming: | 28.7152 |
| LEAP-Seq n confirming: | 485 |
| LEAP-Seq n nonconfirming: | 1204 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAGGGCATTTCAAACAGC |
| Suggested primer 2: | CCCTGTTTAGTTTGGGCTGA |