| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.162151 |
| Chromosome: | chromosome 11 |
| Location: | 2101114 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g469187 | (1 of 98) IPR023214 - HAD-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCGGGGACTGTAGCAGCATTGCTCGTAC |
| Internal bar code: | GGGCGGTAAACAATAGGGAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1002 |
| LEAP-Seq percent confirming: | 66.3751 |
| LEAP-Seq n confirming: | 9408 |
| LEAP-Seq n nonconfirming: | 4766 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTGATGCATGTTTTAGCCG |
| Suggested primer 2: | TAGTGCAACAGTGCCTGTCC |