Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.162244 |
Chromosome: | chromosome 1 |
Location: | 5477634 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g038550 | SQD2 | Sulfoquinovosyldiacylglycerol synthase; (1 of 2) K06119 - sulfoquinovosyltransferase (SQD2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATACGCCTGTTTACACGACTGCTTGTG |
Internal bar code: | GGTCCAGGGCTGCGGTGCTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 674 |
LEAP-Seq percent confirming: | 74.4526 |
LEAP-Seq n confirming: | 102 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCAATATGTCGATCCAGGC |
Suggested primer 2: | CAGACCTAGTCCTTCTGCGG |