| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.162336 |
| Chromosome: | chromosome 7 |
| Location: | 638277 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g316992 | (1 of 3) K14802 - phospholipid-transporting ATPase [EC:3.6.3.1] (DRS2, ATP8A) | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGCAGGACCCCCTCCAAACACGAGGCCT |
| Internal bar code: | GCGGTCAACAATGGCTCAACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 515 |
| LEAP-Seq percent confirming: | 99.7025 |
| LEAP-Seq n confirming: | 16420 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGTTTGTCCAGAAAACAT |
| Suggested primer 2: | AGGCAGAAGCACGCAATACT |