Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.162350 |
Chromosome: | chromosome 13 |
Location: | 835980 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g567250 | (1 of 2) IPR007087//IPR015880 - Zinc finger, C2H2 // Zinc finger, C2H2-like | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGAACCGCGAGCAGCGGCGAAATGCGGA |
Internal bar code: | TGGGTCCGGATCGTGGTGTCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 440 |
LEAP-Seq percent confirming: | 99.734 |
LEAP-Seq n confirming: | 4875 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGGATGAGGTATCAGGAGC |
Suggested primer 2: | GAGAGCATGTGGAGCATGAA |