| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.162453 |
| Chromosome: | chromosome 17 |
| Location: | 463408 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g699100 | TAGL1,TGL20,SDP1,LIP4 | Triacylglycerol lipase; (1 of 1) K14674 - TAG lipase / steryl ester hydrolase / phospholipase A2 / LPA acyltransferase (TGL4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCGCCAGCCGGGACCGTACGGCTGTTGA |
| Internal bar code: | TACAGCCACCTTGGTGGAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 605 |
| LEAP-Seq percent confirming: | 99.2401 |
| LEAP-Seq n confirming: | 653 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGGCTATCCACTTTGAGC |
| Suggested primer 2: | CATCATCATACCCCCAGACC |