Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.162534 |
Chromosome: | chromosome 8 |
Location: | 4125262 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g379800 | (1 of 1) PF00207//PF07974 - Alpha-2-macroglobulin family (A2M) // EGF-like domain (EGF_2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAGTGGGCGTCATTTTGCACAACATCCA |
Internal bar code: | ATGCACTTCACGGAATTCTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 423 |
LEAP-Seq percent confirming: | 99.7508 |
LEAP-Seq n confirming: | 7605 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATTCAATCATCTTCCGCCT |
Suggested primer 2: | CTTGCTGGAGCTAGGGTTTG |