| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.162568 |
| Chromosome: | chromosome 5 |
| Location: | 1190609 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g245500 | FAP175,ANK24 | (1 of 1) PTHR24133//PTHR24133:SF21 - FAMILY NOT NAMED // ANKYRIN REPEAT-CONTAINING PROTEIN; Ankyrin Repeat Flagellar Associated Protein 175 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATTGCGCACAGACCCAGCAGCCCGTTT |
| Internal bar code: | GTCTGGTTTTACGGTGACGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1103 |
| LEAP-Seq percent confirming: | 99.4731 |
| LEAP-Seq n confirming: | 4720 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAAACCAAACACACCCGGA |
| Suggested primer 2: | CACGACCATGGCTGTGTTAC |