| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.162632 |
| Chromosome: | chromosome 9 |
| Location: | 788580 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g402051 | CLV4 | Voltage-gated chloride channel; (1 of 1) PTHR11689//PTHR11689:SF89 - CHLORIDE CHANNEL // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCGCCACATCCGCATCGGTGCTGTTCGT |
| Internal bar code: | AGCTTCGGGGGGTTCGTAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 235 |
| LEAP-Seq percent confirming: | 55.3915 |
| LEAP-Seq n confirming: | 3565 |
| LEAP-Seq n nonconfirming: | 2871 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTCGGTATGACGGCCTAT |
| Suggested primer 2: | CCAGCCCAAACTAAACCAAA |