Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.162737 |
Chromosome: | chromosome 14 |
Location: | 2642434 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g626200 | P4H7,PFH7,PHX18 | Prolyl 4-hydroxylase 7; (1 of 14) K00472 - prolyl 4-hydroxylase (E1.14.11.2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCACTACGTGATGAATGACGCCTACGAC |
Internal bar code: | GATGCGGTGAGTTGGAAGGACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1 |
LEAP-Seq percent confirming: | 62.8895 |
LEAP-Seq n confirming: | 222 |
LEAP-Seq n nonconfirming: | 131 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCTTCCTTCCGTCTTGCTG |
Suggested primer 2: | CGTCAACTAGGCCTCTCCTG |