Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.162739 |
Chromosome: | chromosome 12 |
Location: | 9633672 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g551977 | PHC74 | Putative pherophorin-chlamydomonas homolog; (1 of 1) 2.7.11.1//3.6.5.5 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Dynamin GTPase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACGATGTGCTTGTCCGACCTGCCGACT |
Internal bar code: | TTCTCTTCGCCACGCGGTTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 282 |
LEAP-Seq percent confirming: | 99.8157 |
LEAP-Seq n confirming: | 9207 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCAGACTGTGTGCCTGAT |
Suggested primer 2: | TTCACCACCAGCATCACAAC |