Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.162750 |
Chromosome: | chromosome 12 |
Location: | 6882976 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g560950 | PSAG1,PSAG | (1 of 1) K08905 - photosystem I subunit V (psaG); Photosystem I reaction center subunit V | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATCGCAAGTGCATTTGCTTCTACCGTGG |
Internal bar code: | TGTACAGCAGTCCCGCAAATTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1039 |
LEAP-Seq percent confirming: | 98.5469 |
LEAP-Seq n confirming: | 5968 |
LEAP-Seq n nonconfirming: | 88 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGCCTCCTTATGGTAGTCA |
Suggested primer 2: | AAGCTCGGTCCACTGTCTGT |