| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.162778 |
| Chromosome: | chromosome 7 |
| Location: | 4327184 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g341350 | TRP11 | Transient receptor potential ion channel protein; (1 of 6) PTHR10582 - TRANSIENT RECEPTOR POTENTIAL ION CHANNEL PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACCGGGCTGCACGGAAGCCACGGGCCCT |
| Internal bar code: | TAAAGCTACATGTAATGTTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 503 |
| LEAP-Seq percent confirming: | 94.5537 |
| LEAP-Seq n confirming: | 625 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAACTGCACGCACAAACTT |
| Suggested primer 2: | GATCCTGTTGTGGGTCTCGT |