| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.162793 |
| Chromosome: | chromosome 5 |
| Location: | 2583699 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g236150 | PGM14 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein; (1 of 2) PTHR18901//PTHR18901:SF29 - 2-DEOXYGLUCOSE-6-PHOSPHATE PHOSPHATASE 2 // HALOACID DEHALOGENASE-LIKE HYDROLASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGTGGAGTGGTCGCGCCACGGTACCAGC |
| Internal bar code: | TCGGGACGGTTTATGGCCAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 143 |
| LEAP-Seq percent confirming: | 89.2562 |
| LEAP-Seq n confirming: | 540 |
| LEAP-Seq n nonconfirming: | 65 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTGCTAGCGTGCATGACC |
| Suggested primer 2: | ACGATCTCAACCACCTCGTC |