| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.162814 |
| Chromosome: | chromosome 10 |
| Location: | 5404678 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g458350 | SRR16 | (1 of 1) PTHR22803//PTHR22803:SF55 - MANNOSE, PHOSPHOLIPASE, LECTIN RECEPTOR RELATED // C-TYPE LECTIN DOMAIN-CONTAINING PROTEIN 162; Scavenger receptor cysteine rich (SRCR) protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGACTGCTGGGAACGCAGCGGCCCGCGTA |
| Internal bar code: | CAACACCTTCCATCCGCCTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1100 |
| LEAP-Seq percent confirming: | 98.1361 |
| LEAP-Seq n confirming: | 2106 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAGCTGAAGTTGTTGGTA |
| Suggested primer 2: | GGTCAACGTACGGCAATTCT |