Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.162836 |
Chromosome: | chromosome 12 |
Location: | 3341274 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g497500 | SNE7 | (1 of 8) PTHR10366:SF411 - HIGH CHLOROPHYLL FLUORESCENCE PHENOTYPE 173 PROTEIN; Cinnamoyl-CoA reductase/flavanone 4-reductase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCAAGAGGGGCTTGTGTTGGCCGTGGGA |
Internal bar code: | TGTTCTGCGTGGTGCCCAACGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 556 |
LEAP-Seq percent confirming: | 97.7467 |
LEAP-Seq n confirming: | 3080 |
LEAP-Seq n nonconfirming: | 71 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCACGTAGCCAGCAATGA |
Suggested primer 2: | ATACATGGTGGCAAGCAACA |