Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.162856 |
Chromosome: | chromosome 16 |
Location: | 1706418 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g654800 | CPC2 | Central pair microtubule complex 2; (1 of 1) PTHR24198//PTHR24198:SF25 - ANKYRIN REPEAT AND PROTEIN KINASE DOMAIN-CONTAINING PROTEIN // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCGACCAGCTGCTGAGCCACATCCCAC |
Internal bar code: | AGTCTTCGCACGGGCGTTGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 663 |
LEAP-Seq percent confirming: | 91.7157 |
LEAP-Seq n confirming: | 1871 |
LEAP-Seq n nonconfirming: | 169 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGAACACCGTATGAGGCAC |
Suggested primer 2: | GGCCTTGTGGTCTGTTGTTT |