Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.162938 |
Chromosome: | chromosome 5 |
Location: | 3378452 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g240900 | (1 of 1) IPR000001//IPR024079 - Kringle // Metallopeptidase, catalytic domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGAGGCGGGGTCCGCCACCTCGCACCTG |
Internal bar code: | CCGGTCAAGGGAAGGGTTTCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 848 |
LEAP-Seq percent confirming: | 99.8162 |
LEAP-Seq n confirming: | 1086 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTACTGGGAACGCCGTAGTC |
Suggested primer 2: | GCTCAACCCGGTCATGTACT |