| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.163027 |
| Chromosome: | chromosome 10 |
| Location: | 5466884 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g458800 | SRR31 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 20) IPR001190//IPR017448 - SRCR domain // SRCR-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGCAGTACACAGATAGGGTAGGGTGGA |
| Internal bar code: | TTGTGTCCTGTTTTTGTGATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1009 |
| LEAP-Seq percent confirming: | 93.1275 |
| LEAP-Seq n confirming: | 2534 |
| LEAP-Seq n nonconfirming: | 187 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCCAACATAGAGGCGTGT |
| Suggested primer 2: | TAATAGCCACAAAAAGGGCG |