| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.163036 |
| Chromosome: | chromosome 7 |
| Location: | 872057 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318651 | AOF4 | (1 of 1) 1.5.3.16 - Spermine oxidase / SMO; Flavin-containing amine oxidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGCGCCCGGGGCATCGGCGGCGGGCGG |
| Internal bar code: | GGGGGAGGTGTGCGTTGGGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 534 |
| LEAP-Seq percent confirming: | 77.9528 |
| LEAP-Seq n confirming: | 99 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGCACCCCGTATATGTGT |
| Suggested primer 2: | TTCACTGCATCCTCTGTTGC |