Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.163068 |
Chromosome: | chromosome 4 |
Location: | 356723 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g217911 | (1 of 752) IPR027417 - P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCGACATACCTCATCCTGCGGCTCCTGA |
Internal bar code: | GAGGCGCACCGAAGCATTGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 965 |
LEAP-Seq percent confirming: | 99.7773 |
LEAP-Seq n confirming: | 44353 |
LEAP-Seq n nonconfirming: | 99 |
LEAP-Seq n unique pos: | 213 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGATCGCCTCAAGTATGGTT |
Suggested primer 2: | TTAAGTGTTGCAGGCAGGTG |