| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.163084 |
| Chromosome: | chromosome 2 |
| Location: | 2312576 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g090650 | SEC20 | (1 of 1) K08497 - protein transport protein SEC20 (SEC20); Qb-SNARE protein, Sec20-family | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGCGCTGCTCTTGTCGGGGGGGGGGCT |
| Internal bar code: | CGTCCAGAGTATGGGGTTCCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 420 |
| LEAP-Seq percent confirming: | 99.7483 |
| LEAP-Seq n confirming: | 4359 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTACGGGATCAGGATCAG |
| Suggested primer 2: | CGCTTGTCGAGGTAGGTGAT |