| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.163191 |
| Chromosome: | chromosome 8 |
| Location: | 4701164 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g383900 | (1 of 125) IPR001841 - Zinc finger, RING-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGCGGCGGCGGCGGCACAGGGGCGGCC |
| Internal bar code: | CGGTTCGGGATCTGAGGGCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1060 |
| LEAP-Seq percent confirming: | 88.7742 |
| LEAP-Seq n confirming: | 5591 |
| LEAP-Seq n nonconfirming: | 707 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGATGCAGTGGATGGAG |
| Suggested primer 2: | GACTGACGACGCTTGACAAA |