| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.163220 |
| Chromosome: | chromosome 13 |
| Location: | 3712843 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g589200 | (1 of 21) IPR011016 - Zinc finger, RING-CH-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGCTGTGGCTGGGGGAGACATGGCTGCT |
| Internal bar code: | CCCTTCCCTGGCATCAAAGAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 915 |
| LEAP-Seq percent confirming: | 74.0132 |
| LEAP-Seq n confirming: | 900 |
| LEAP-Seq n nonconfirming: | 316 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTGCATCTGCTGTTGCTG |
| Suggested primer 2: | CCGCTAGAGAAGGTAGGGCT |