| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.163225 |
| Chromosome: | chromosome 7 |
| Location: | 1289127 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g321900 | (1 of 6) 3.1.26.11 - Ribonuclease Z / tRNase Z | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACACGTCAAATCACCCCCCGAACTCCC |
| Internal bar code: | ATGGAATGTGTGCCGGCCGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 414 |
| LEAP-Seq percent confirming: | 84.3034 |
| LEAP-Seq n confirming: | 4157 |
| LEAP-Seq n nonconfirming: | 774 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGTCCCTGTCGTTGCCAT |
| Suggested primer 2: | GGTTATGTGTGTCACCGCAG |