Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.163277 |
Chromosome: | chromosome 17 |
Location: | 2094390 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g712200 | (1 of 1) K11850 - ubiquitin carboxyl-terminal hydrolase 26/29/37 [EC:3.4.19.12] (USP26_29_37) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATAGTGTAGTGTATGTTCTAGGACAGCT |
Internal bar code: | CCTTGGCTGGTCGTGAGTATTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1134 |
LEAP-Seq percent confirming: | 92.3872 |
LEAP-Seq n confirming: | 2682 |
LEAP-Seq n nonconfirming: | 221 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACATGCTGTTCTTCGCCA |
Suggested primer 2: | ACAACTGGAGAGGGTTCGTG |