| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.163303 |
| Chromosome: | chromosome 16 |
| Location: | 2547456 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g661350 | RBCMT1,RMT1 | (1 of 1) K00592 - [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase (E2.1.1.127); ribulose-1%252C5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCCCGCCACCTGCGTGCCCGCCAGAGC |
| Internal bar code: | CTGATTGAGCTGGCGTTCGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 998 |
| LEAP-Seq percent confirming: | 99.6969 |
| LEAP-Seq n confirming: | 11514 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCGAAGAGCTAAGGCAGA |
| Suggested primer 2: | CAGATTCCCACCAGACCTGT |