Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.163319 |
Chromosome: | chromosome 3 |
Location: | 6183000 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g192250 | PHC69 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 69 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCACCGCCGAACAGCGGCAGCGCACTGGG |
Internal bar code: | GTTGGGTGAGCACGCGTAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 223 |
LEAP-Seq percent confirming: | 71.1592 |
LEAP-Seq n confirming: | 1547 |
LEAP-Seq n nonconfirming: | 627 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTGGTTTGACCGCTACCAG |
Suggested primer 2: | GATTGTGCAAGACCTGCTGA |