| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.163327 |
| Chromosome: | chromosome 2 |
| Location: | 7215459 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g146050 | ATO2 | (1 of 1) 2.3.1.9 - Acetyl-CoA C-acetyltransferase / Acetoacetyl-CoA thiolase; Acetyl-CoA acyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTTAATTACTAATCACGCACGCGGAGGC |
| Internal bar code: | AGTTGACTGTGTGCTGATGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1200 |
| LEAP-Seq percent confirming: | 99.8319 |
| LEAP-Seq n confirming: | 2375 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCCGTACCTTCACACAC |
| Suggested primer 2: | GGCGTTCTCTACTTTCGTCG |