Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.163358 |
Chromosome: | chromosome 12 |
Location: | 1742446 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g512600 | RPL18 | Ribosomal protein L18, component of cytosolic 80S ribosome and 6 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTTGGGAACATGGGCCATCCGGCTGTCG |
Internal bar code: | GCGCCAGGATTATTGCTGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 704 |
LEAP-Seq percent confirming: | 97.7876 |
LEAP-Seq n confirming: | 884 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCTCTGGCGATGGTGTAAC |
Suggested primer 2: | AAGCTGACATTGATTTGGGG |