| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.163427 |
| Chromosome: | chromosome 2 |
| Location: | 18338 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g073150 | (1 of 1) IPR001841//IPR029071 - Zinc finger, RING-type // Ubiquitin-related domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCGCTATCAAAGATTTGAGGGATTGTTT |
| Internal bar code: | ACCTTGGCTGCCAGCCCGTATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1073 |
| LEAP-Seq percent confirming: | 99.3279 |
| LEAP-Seq n confirming: | 2069 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAACGGTAAGCAGTGCAAG |
| Suggested primer 2: | AAAATCTGCAGAGCCAGGAA |