Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.163432 |
Chromosome: | chromosome 12 |
Location: | 8568273 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g547351 | (1 of 5) IPR001054//IPR006189//IPR029787 - Adenylyl cyclase class-3/4/guanylyl cyclase // CHASE domain // Nucleotide cyclase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAACAGATTCAGGCTCTTAATTAATCATT |
Internal bar code: | CCGCGCGCTTTGTAACAATTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 604 |
LEAP-Seq percent confirming: | 78.5714 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGGCGTACTAGTCAAGGG |
Suggested primer 2: | CTTGCGTTTCGAGAGTAGGG |