| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.163532 |
| Chromosome: | chromosome 9 |
| Location: | 7724224 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g415950 | PRPL6,uL6m,MRPL6 | (1 of 1) K02933 - large subunit ribosomal protein L6 (RP-L6, MRPL6, rplF); Mitochondrial/chloroplast ribosomal protein L10 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGGAAACTCCAGCGGCAAGCGAGTGG |
| Internal bar code: | ACAATGGTGTGGCCTGTTGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 707 |
| LEAP-Seq percent confirming: | 99.464 |
| LEAP-Seq n confirming: | 7980 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCGGCAAGCTGAGGTATC |
| Suggested primer 2: | CCTCGACTCAGGTGGAGAAG |