| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.163549 |
| Chromosome: | chromosome 4 |
| Location: | 1224692 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g215350 | (1 of 1) K14552 - NET1-associated nuclear protein 1 (U3 small nucleolar RNA-associated protein 17) (NAN1, UTP17, WDR75) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAGCGCTGCCCGGCACTGCCGCGACCGA |
| Internal bar code: | GTACTCGTGGTTCCCTCTTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 100 |
| LEAP-Seq percent confirming: | 99.3103 |
| LEAP-Seq n confirming: | 144 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACAACCTTCTAACCGCCG |
| Suggested primer 2: | GGGAGACAGGCTGAGAGTTG |