Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.163549 |
Chromosome: | chromosome 4 |
Location: | 1224692 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g215350 | (1 of 1) K14552 - NET1-associated nuclear protein 1 (U3 small nucleolar RNA-associated protein 17) (NAN1, UTP17, WDR75) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAGCGCTGCCCGGCACTGCCGCGACCGA |
Internal bar code: | GTACTCGTGGTTCCCTCTTCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 100 |
LEAP-Seq percent confirming: | 99.3103 |
LEAP-Seq n confirming: | 144 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTACAACCTTCTAACCGCCG |
Suggested primer 2: | GGGAGACAGGCTGAGAGTTG |