| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.163562 |
| Chromosome: | chromosome 2 |
| Location: | 414491 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076100 | (1 of 3) IPR000237 - GRIP | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCATACGTAATGCGCGGCCGTGTATACA |
| Internal bar code: | AGACGGAATGTACGCCACGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 240 |
| LEAP-Seq percent confirming: | 40.4551 |
| LEAP-Seq n confirming: | 2009 |
| LEAP-Seq n nonconfirming: | 2957 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTACGGCACATTCAAACC |
| Suggested primer 2: | GTGCACTTTCGTGCTGTGTT |