| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.163591 |
| Chromosome: | chromosome 1 |
| Location: | 7633372 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g055250 | (1 of 2) 2.1.1.11 - Magnesium protoporphyrin IX methyltransferase / S-adenosylmethioninemagnesium protoporphyrin methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCGCATCGCGACACAAACTACTGTAAC |
| Internal bar code: | GCTGTCGGCTTTCTGATGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 358 |
| LEAP-Seq percent confirming: | 99.793 |
| LEAP-Seq n confirming: | 1446 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGGGAAGAGTGGAGGTGT |
| Suggested primer 2: | TTCTGGTGGGTAGGGACTTG |