| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.163605 |
| Chromosome: | chromosome 1 |
| Location: | 6049915 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g042950 | (1 of 2) PF05255 - Uncharacterised protein family (UPF0220) (UPF0220) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGGATGCAGAGCAGGGCCAGGGTCCGG |
| Internal bar code: | ACAGCGATAGCGGGCCCGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 702 |
| LEAP-Seq percent confirming: | 94.3211 |
| LEAP-Seq n confirming: | 1827 |
| LEAP-Seq n nonconfirming: | 110 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGCCTATCTAGCAGTCGC |
| Suggested primer 2: | CCACCCTTCAAAGCAACAAT |