| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.163766 |
| Chromosome: | chromosome 16 |
| Location: | 196707 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g694850 | NGS1,NAGS1 | N2-acetyl-L-ornithine:L-glutamate N-acetyltransferase; (1 of 1) 2.3.1.1//2.3.1.35 - Amino-acid N-acetyltransferase / N-acetylglutamate synthase // Glutamate N-acetyltransferase / Ornithine transacetylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGCCTGCTCTTCCTGGCTCTTCCCGGC |
| Internal bar code: | CGTACTCAGTATGAAATCACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 704 |
| LEAP-Seq percent confirming: | 99.6344 |
| LEAP-Seq n confirming: | 545 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGATCAACGCCGAGTACA |
| Suggested primer 2: | GATGGGGGTTTGTTTGTTTG |