| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.163807 |
| Chromosome: | chromosome 17 |
| Location: | 1605611 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g707800 | SNRK2J | (1 of 4) PTHR24343//PTHR24343:SF167 - SERINE/THREONINE KINASE // SUBFAMILY NOT NAMED; snRK1 family in Chlamydomonas, subgroup 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCATCATCGGCCCTCCTGGCGGCCCAGCA |
| Internal bar code: | GTACACAAGAAGGATTCAACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 499 |
| LEAP-Seq percent confirming: | 87.7165 |
| LEAP-Seq n confirming: | 557 |
| LEAP-Seq n nonconfirming: | 78 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCCAGCAATTCCGTACT |
| Suggested primer 2: | ACCCAACCAATTACCAGCAG |