| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.163881 |
| Chromosome: | chromosome 4 |
| Location: | 2358361 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g220900 | GT90-4,GT90F4 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 4 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGCCCTGCCTGCTGCGCAACGGCCCCGC |
| Internal bar code: | AGGGACTTGTGCTAGGAAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 703 |
| LEAP-Seq percent confirming: | 92.7168 |
| LEAP-Seq n confirming: | 2737 |
| LEAP-Seq n nonconfirming: | 215 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCAGGACCCATAACTGG |
| Suggested primer 2: | GTGTTTGTGCAGGATGTTGG |