| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.163918 |
| Chromosome: | chromosome 1 |
| Location: | 3883731 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g025250 | RFK2 | Riboflavin kinase; (1 of 1) PTHR22749//PTHR22749:SF2 - RIBOFLAVIN KINASE/FMN ADENYLYLTRANSFERASE // RIBOFLAVIN KINASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTGCATTCCGCATCAGGGCCCGGCGCTT |
| Internal bar code: | TTGTGATACTCAACGGCCCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 134 |
| LEAP-Seq percent confirming: | 47.8873 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCCACGTTTTCCTCATA |
| Suggested primer 2: | GTCTCGCTTCACTGCTACCC |