| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.163989 |
| Chromosome: | chromosome 12 |
| Location: | 4348777 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g520150 | SPLH3,SPL23 | (1 of 3) K12818 - ATP-dependent RNA helicase DHX8/PRP22 (DHX8, PRP22); DEAD/DEAH box helicase, possible nuclear pre-mRNA splicing factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCGAGCCGGTCTCTCCAATTACGACTA |
| Internal bar code: | ACTACAGCTGGGCGGACAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 378 |
| LEAP-Seq percent confirming: | 98.9758 |
| LEAP-Seq n confirming: | 1063 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGTCGTGGTAAACTGCCC |
| Suggested primer 2: | AGGCTGACACCGTCATCTTC |