| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.164031 |
| Chromosome: | chromosome 2 |
| Location: | 5031437 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g104400 | (1 of 1) IPR000104//IPR005033 - Antifreeze protein, type I // YEATS | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCAGTGACGCGCCTGTGTCCTGCCTGC |
| Internal bar code: | CTGAGCAATGCAATTGAGCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 974 |
| LEAP-Seq percent confirming: | 91.3462 |
| LEAP-Seq n confirming: | 95 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTGGATGCTGTGGTGTTT |
| Suggested primer 2: | GCCTTTATGGCTGCGTCTAC |