Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.164069 |
Chromosome: | chromosome 4 |
Location: | 2394703 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g221200 | CGL109 | Conserved in the Green Lineage; (1 of 1) IPR001005//IPR001965//IPR009057//IPR011011//IPR013083//IPR017877 - SANT/Myb domain // Zinc finger, PHD-type // Homeodomain-like // Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type // Myb-like domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCTCTATGCTTTGTTGGAGTGTGGGGCG |
Internal bar code: | TCATTTACGCCAGTATAACCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 583 |
LEAP-Seq percent confirming: | 98.2955 |
LEAP-Seq n confirming: | 1211 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCTGAGTGGTCGTCTGTTC |
Suggested primer 2: | CAACGGCTTATTCCGATGTT |