| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.164095 |
| Chromosome: | chromosome 3 |
| Location: | 1926281 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g155300 | PHC29 | (1 of 1) IPR000095//IPR024616 - CRIB domain // Pherophorin; Putative pherophorin-chlamydomonas homolog | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCTTAACCAACACCACGCACCAACCTA |
| Internal bar code: | GCATTGCGAGGGGGACGCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 971 |
| LEAP-Seq percent confirming: | 99.8167 |
| LEAP-Seq n confirming: | 2178 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGACGACAGCTCGACTC |
| Suggested primer 2: | CTCCTCCAAGTACAGCAGCC |