| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.164111 |
| Chromosome: | chromosome 12 |
| Location: | 9608038 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g550277 | MRS2 | Mg2+ transporter protein, CorA-like and putative mitochondrial splicing factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGTGCGGTGCAGCGTTCTCACAGGAAC |
| Internal bar code: | CCGGATAGGGACGTCATGAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 719 |
| LEAP-Seq percent confirming: | 82.6218 |
| LEAP-Seq n confirming: | 2748 |
| LEAP-Seq n nonconfirming: | 578 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGAACCTCACCAACAGGC |
| Suggested primer 2: | AAGCAAATTTCGTTCCGTTG |