Insertion junction: LMJ.RY0402.164136_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.164136
Chromosome:chromosome_10
Location:1652047
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TCTCACACCCACATCCCCGCACCCCCACAC
Internal bar code:GGCGGTAGCCTACGGGTTGCTA

Confirmation - LEAP-Seq

LEAP-Seq distance:71
LEAP-Seq percent confirming:88.6271
LEAP-Seq n confirming:865
LEAP-Seq n nonconfirming:111
LEAP-Seq n unique pos:15

Suggested primers for confirmation by PCR

Suggested primer 1:CGTGTGTGTGTGGTGTGTGT
Suggested primer 2:GTGCTACCACCTGTCTGCAA