| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.164209 |
| Chromosome: | chromosome 2 |
| Location: | 612060 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g077850 | FAP212,CSE14 | Flagellar Associated Protein 212; (1 of 6) 3.2.1.4 - Cellulase / Endoglucanase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCATGCTGCATGCATTATAGAGCATTGA |
| Internal bar code: | CATTTCGCGCCGGTGCCCCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 718 |
| LEAP-Seq percent confirming: | 86.0727 |
| LEAP-Seq n confirming: | 995 |
| LEAP-Seq n nonconfirming: | 161 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGCAAACACCCATTTTT |
| Suggested primer 2: | CGAACTCCACACCCAGAAAT |