| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.164224 |
| Chromosome: | chromosome 4 |
| Location: | 1288344 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214800 | VMPL1,VMP6 | (1 of 10) PF00957 - Synaptobrevin (Synaptobrevin); Endosomal R-SNARE protein, VAMP-like family (R.III) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGCCCTTGATTGCGCAACGCATGCGTAT |
| Internal bar code: | GCTGGCCGTTGTACCGGTCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 499 |
| LEAP-Seq percent confirming: | 96.1991 |
| LEAP-Seq n confirming: | 1063 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGATGCTTGGTTTCACTC |
| Suggested primer 2: | CCATCACACGTCCATACAGC |